Mr. William Clifton , Principal
10708 St Rr 118 South
Van Wert Ohio 45891
(Voice) 419-238-3350
(Fax) 419-238-0525
Office Hours 7:30-3:30
In Session 7:55-3:00

Mrs. Overmyer's Homework Page



  09/24/14

>Sequence 1
TCGAAATAACGCGTGTTCTCAACGCGGTCGCGCAGATGCCTTTGCTCATC
AGATGCGACCGCAACCACGTCCGCCGCCTTGTTCGCCGTCCCCGTGCCTC
AACCACCACCACGGTGTCGTCTTCCCCGAACGCGTCCCGGTCAGCCAGCC
TCCACGCGCCGCGCGCGCGGAGTGCCCATTCGGGCCGCAGCTGCGACGGT
GCCGCTCAGATTCTGTGTGGCAGGCGCGTGTTGGAGTCTAAA

>Sequence 2
GTTTATTAGTGATCATGGCTAAGTTTGCGTCCATCATCGCACTTCTTTTT
GCTGCTCTTGTTCTTTTTGCTGCTTTCGAAGCACCAACAATGGTGGAAGC
ACAGAAGTTGTGCGAAAGGCCAAGTGGGACATGGTCAGGAGTCTGTGGAA
ACAATAACGCATGCAAGAATCAGTGCATTAACCTTGAGAAAGCACGACAT
GGATCTTGCAACTATGTCTTCCCAGCTCACAAGTGTATCTGCTACTTTCC
TTGTTAATTTATCGCAAACTCTTTGGTGAATAGTTTTTATGTAATTTACA
CAAAATAAGTCAGTGTCACTATCCATGAGTGATTTTAAGACATGTACCAG
ATATGTTATGTTGGTTCGGTTATACAAATAAAGTTTTATTCACCA

>Sequence 3
CTCGAGACTAGTTCTCTCTCTCTCTCTCTCGTGCCGCATCTCACACCTGT
GGATGGACGGCAGCTGAACCGCGGGAAACTTTCGTTCTCACTCTACCTAG
ATGAACTTTAGTTTATATTAAACACGCGTCGACTCCCACACAAACCGTGC
TCGTTTTACATCTTTGTCTCCGCTTTTGAAAACGAGAAGTTGAATTCGCA
AGACGCAACTTTCCAGCCCCTCACTGAGCGGGCAGAGTCCGTGAAGCGAT
GGAGCCGTCCGTCATTCCCGGTGCTGACATACCCGACCTTTACTCCATTA
ACCCGTTTAATGTCACTTTTCCCGACGACGTTTTGAGTTTCGTTCCTGAT
GGGAGGAACTACACCGAACCTAACCCGGTAAAGAGCCGCG GAATCATCA
TCGCCATTTCCATCACCGCTC

>Sequence 4 
GACATTACGGCGACCCAGTCTCCCCCGGTGTTGTCAGTGGGACTGGGCC
AGACCGCAACCATCACTTGTACGGCCAGTCAAAGCATCTACAGTAACCT
TGCTTGGTACCAGCAGAGAGAAGGACAGAAGCCCTCTCTCCTGATCTAT
GCTGCGACAACGCGATACGAAGGAGTCTCCGAGCGATTCAGCGGCAGTG
GATCAGGGACCAGTTTCACCCTGACAATCAGCAACGTTCAGAATGAGGA
TGTCGCTGACTATTACTGTCAGATCGCATATTCGATCTACTCCGGTTCC
GTTGTTTTCGGTGAAGGAACCAAGCTCAGACTGAGCCGT

>Sequence 5
GAATTCGCGGCCGCATGGGGGAGAAGCTGCCGGTTGTGTATAAACGCTT
CATCTGCTCGTTCCCGGATTGTAATGCCACGTATAACAAGAACCGGAAG
CTGCAGGCCCATCTGTGCAAGCACACGGGGGAGAGACCGTTTCCTTGCA
CATATGAAGGCTGTGAGAAAGGCTTTGTGACGCTGCATCACCTGAATCG
TCATGTGCTCTCCCACACCGGGGAGAAACCCTGCAAATGCGAAACGGAA
AATTGCAATTTGGCGTTCACCACAGCATCCAACATGAGGTTGCACTTCA
AAAGGGCTCATTCTTCTCCGGCGCAGGTCTACGTGTGTTATTTCGCAGA
CTGTGGCCAGCAGTTCAGGAAACATAACCAGCTAAAAATTCACCAGTAT
ATCCATACAAACCAGCAACCCTTCAAAT

>Sequence 6 
GCCCAGCGTCTCTCGGAGGAAGCTAATTCTCAGGTTATCGCAGAGGAATC
TCTTGTAGCTCGTGCTGAGGCTACCGTTGTCCAAGCCGCCGCTCCAACCA
AATCCCTTGATCTGACAACATGGAAGTATGCTGATCTCAGAGACACTATC
AACACCTCAATCGATATTGCGCTCCTGTCAGCCTGCAAGGAGGAGTTCCA
TCGTCGTCTCAAGGTCTACCACGCCTGGAAGATGAAGAATAAGAAGGTTG
CCGCCGGCGACAAGGGCGGACCAGAGAGGGCTCCACAATCCATCTTTGAA
AGTGCCCAACAATACAACCAGCTGGCACCCCCTCCGAAAGCCACCAAGGC
TGCCCCAGCCAATCAGAACATCCAACGCTTCTTCAGGGTGCCTTTCTCCG
TGACTGGGTCCACCGCTCAGGGTCAGATGCCCGAGAGGGGTTGGTGGTAC
GCCCACTTTGACGGTCAGTGGATCGCCCGCCAGATGGAGGTACACCCCAC
CAAGGTCCCCGTTCTTCTGGTTGCAGGTAAAGATGATGAGAACATGTGTG
AGATGAGTTTGGAGGAGACTGGGTTGACACGACGTCCCAACGCCGAGATC
GTCGAGCGGGAGTTTGAGGAGCCCTGGAAGCGTAGCGGCGGTCAGCAGTA
CCACATGGCTGCAGTACGCAACAAGCAGGCTAGACCAACGTGGGCCACGC
AGAGCTTGAA

>Sequence 7
AACAATTCATTTTTCCTGCTTTCCTAGAAAATTCTATAAAAGCTTCAAAA
TGAATTACTTGGTGATGATTAGTTTGGCACTTCTCTTCGTGACAGGTGTA
GAGAGTGTAAAAGACGGTTATATTGTCGACGATGTAAACTGCACATACTT
TTGTGGTAGAAATGCATACTGCAACGAGGAATGTACCAAGTTGAAAGGTG
AGAGTGGTTATTGCCAATGGGCAAGTCCATATGGAAACGCCTGTTATTGC
TATAAATTGCCCGATCATGTACGTACTAAAGGACCAGGAAGATGCCATGG
CCGATAAATTATAAGATGGAATGTATCCTAAGTATCAATGTTAAATAAAT
ATAATCAAAAAATT

>Sequence 8
ACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGTAAGGTTGG
GAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGAT
GGCGCAGGGGATCAAGATCTGATCAAGAGACAGGATGAGGATCGTTTCGC
ATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGA
GAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATG
CCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAG
ACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCT
ATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTG
TCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAG
GATCTCCTGTCATCTCACCTTGCTCCTGCC

>Sequence 9
TCTTGGTGAGGATCCGTTGAGAACAACCCAACCGCCGCCCCATCGCCCTN
GTTAGANTNATGGCCGCGTCGGCGCTGCACCAGACCACCAGCTTCCTCNG
CACCGCCCCTCGCCGGGATGAGCTCGTCCGCCGCGTCGGCGACTCCGGTG
GCCGCATCACCATGCGCCGCACCGTCAAGAGCGCGCCCCAGAGCATCTGG
TATGGACCTGACCGTCCCAAGTNCCTGGGCCCGTTCTCGGAGCAGACGCC
ATCGTACCTGACCGGAGAGTTCCCGGGAGACTACGGGTGGGACACGGCGG
GGCTATCGGCCGACCCGGANACGTTCGCTATGAACAGGGAGCTGGANGTG
ATCCACTCNCGGTGGGCGATGCTGGGGGCGCTGGGCTGCGTCTTCCCGGA
GATCCTGTCCAANAACGGGG

>Sequence 10
AGAACTACCAAGATGCTGCTCAGGTCAGAGATTGTCGTCTGTCTGGCCTT
CTGGATCTTGCACTTGAGAAAGATTATGTTCGAACCAAGGTGGCTGACTA
TATGAACCATCTCATTGACATTGGCGTACAGGGTTCAGACTTGATGCTTC
TAAGCACATGTGGCCTGGAGACATAAAGGCAATTTTGGACAAACTGCATA
ATCTCAATACAAAATGGTTCTCCCAAGGAAGCAGACCTTTCATTTTCCAA
GAGGTGATTGATCTGGGTGGTGAGGCAGTGTCAAGTAATGAGTATTTTGG
AAATGGCCGTGTGACAGAATTCAAATATGGAGCAAAATTGGGCAAAGTTA
TGCGCAAGTGGGATGGAGAAAAGATGTCCTACTTAAAGAACTGGGGAGAA
GGTTGGGGTTTGATGCCTTC

>Sequence 11
TGCATCACAAGGTTAATGTGAAAACACAGCGAGAAGTCCATTTCCCAATG
GACCTCTTGCAAGCCTGTGGTGCATCTGCCCCTAGGCCAGTTGCCCGTGT
TTCACGTGCAACCGACCTAGACCGACGCTACAGGTGCGTCCTCAGTTTAC
CTGAGGAGCGTGCTCGCAGTGTTGGGTGTAAATGGTCGTCGACCCGAGCG
GCGTTACGACGTGGACTCGAGGAGCTTGGCTCCCGCGAGTTCCGCCGTCG
TCTCCGTTTGGCGGACGATTGCTGGCGCGCGATCTGCGCGGCCGTCTGCA
CGGGTCGGAAGTTTCCTTCCTTCTCGGTGACAGATCGGCCGGCAAGAGCT
CGCCTTGCAAAAGTCTACCGTATGGGTCGTCGACTGCTAGTAGGTGTGGT
CTGCCGAGGCGAATCGGTCG

>Sequence 12
ATAACCACACGCCTTTGGCGTGATTATCAGCTTTCAAGTTTCAGTTACTA
AAACTAATACTGACTATAAAACAGAAGCAAAAAAATTTTCGATTTTTATG
AAAACGGTCGCAAAGAAGTTAGCAAAAATATATAATTTCTTTTGAAATTG
TTCACTTGGCCAAGCTGCAGTTTCAATATTTTAATAAAGGGGGCAGTAAA
AAGTGAAAAAAAAGAAAAGTTTCTGGCTTGTTTCTTTTTTAGTTATAGTA
GCTAGTGTTTTCTTTATATCTTTTGGATTTAGCAATCATTCTAAACAAGT
TGCTCAAGCGGCTAGTGATACGACATCAACTGATCACTCAAGCAATGATA
CAGCTGATTCTGTTAGCGACGGTGTTATTTTGCATGCATGGTGCTGGTCG
TTCAACACGATTAAAAACAACTTGAAACAGATTCATGACGCCGGCTACAC
AGCGGTTCAAACTTCACCTGTTAATGAAGTTAAAGTTGGAAATAGCGGGT
CTAAGTCATTAAATAACTGGTATTGGCTATATCAGCCAAC

>Sequence 13
GTGCGCGTTAGACCATATAAAGAAAAACCAATACAAACTCCAGCAAAATC
TGTTGATATAAGATATACTGTACAGTTTACTCCTTTAAACCCTGATGATG
ATTTCAAGCCAGTTCTCAAAGATACTAAACTATTGAAAACATTAGCTATC
GGCGACACCATCACATCCCAAGAATTACTAGCTCAAGCACAAAGCATTTT
AATCGAAAGCCATCCAGATTATACGATTTATGAACGTGATTCCTCAATCG
TCACTCATGACAATGACATTTTCCGTACGATTTTACCAACGGATCAAGAG
TTTACTTACCATGTCAAAAATCGGGAACAAGCTTATAAGGCCAATTCTAA
AACAGATATTAAAGAAAAAACGAACAACACCGAC

>Sequence 14
CTAATAATCCTTGGAATACTCCTATATTTTGTATAAAGAAGAAATCAGGG
AAATGGAGAATGCTAATTGATTTTAGAGAACTTAATGCAAAAACAGAAAA
AGGAGCAGAAGTCCAATTAGGATTACCTCACCCATCTGGATTACAGAAGA
GAAAGAATGTAACAGTTTTAGATATAGGAGATGCTTATTTTACCATCCCT
TTAGATCCTGATTATCAGCCCTATACTGCATTTACTTTACCATCTAAGAA
TAATCAAAGTCCAGGAAAAAGGTATATTTGGAAATCTCTTCCACAGGGGT
GGGTCTTGAGTCCCTTAATATACCAGAGCACTCTAGATAATATTCTACAA
CCATTTAGAA

>Sequence 15
ATGTTTTCCGGTGGCGGCGGCCCGCTGTCCCCCGGAGGAAAGTCGGCGGC
CAGGGCGGCGTCCGGGTTTTTTGCGCCCGCCGGCCCTCGCGGAGCCGGCC
GGGGACCCCCGCCTTGCTTGAGGCAAAACTTTTACAACCCCTACCTCGCC
CCAGTCGGGACGCAACAGAAGCCGACCGGGCCAACCCAGCGCCATACGTA
CTATAGCGAATGCGATGAATTTCGATTCATCGCCCCGCGGGTGCTGGACG
AGGATGCCCCCCCGGAGAAGCGCGCCGGGGTGCACGACGGTCACCTCAAG
CGCGCCCCCAAGGTGTACTGCGGGGGGGACGAGCGCGACGTCCTCCGCGT
CGGGTCGGGCGGCTTCTGGCCGCGGCGCTCGCGCCTGTGGGGCGGCGTGG
ACCACGCCCCGGCGGGGTTCAACCCCACCGTCACCGTCTTTCACGTGTAC
GACATCCTGGAGAACGTGGAGCACGCGTAC

>Sequence 16
CTCGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGGATCTGCCCGA
TAGAGGGGGATAACCACTGGAAACGGTGGCTAATACCGTATAACGTCGCR
AGACCAAAGAGGGGGACCTTCGGGCCTCTCACTATCGGATGAACCCAKAT
GGGATTAGCTAGTRSGCGGGGTMACGGGCCCACCTAGGCGACKATCCCTA
GCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGASACACGGYCCASA
CTCCTACGGGRGGCAGCAGKGGGGAATATTGCACARTGGGCGCAMGCCTG
ATGCASCCATGCCGYGTGTATGAAGARGGCCTTCGGGTTGTAAAGTWCTT
TCAGCGGGGAGGAAGGCKATGTGGTTAATAACCGCVTYGATTGACGTTAC
CCGCAGAAGAAGCACCGKCTAACTCCGTGCCAGCAGCCGCGGTWATACGG
AGGG